For each sample, DNA sequences of the seven alleles were manually assembled to obtain 3098 nucleotides. Sanger sequencing of both DNA strands was performed by Eurofins Genomics (85560 Ebersberg, Germany), and the numbers for alleles and the sequence type (ST) were assigned in accordance with the Chlamydiales MLST database and uploaded on the PubMLST website. Fragments of seven housekeeping genes, namely gatA, oppA3, hflX, gidA, enoA, hemN and fumC, were amplified and sequenced using the primers and conditions described on the Chlamydiales MLST website. abortus-positive samples, according to Pannekoek et al. The MLST analysis was performed on the C. abortus rtPCRs are shown in Table S1 and Figure S1, respectively. Specificity and sensitivity of in-house enoA-based C. The reaction of rtPCR was carried out in 7500 or ViiA7 apparatus (Applied Biosystems, Waltham, MA, USA) using the following cycling parameters: 50 ☌ for 2 min, 95 ☌ for 20 s, 45 cycles of 95 ☌ for 3 s and 60 ☌ for 30 s. DNA amplification was performed in a final volume of 20 µL containing 10 µL of TaqMan TM Fast Advanced Master Mix (Applied Biosystems, Waltham, MA, USA), 0.6 µM of each primer, 0.1 µM of the probe, 2 µL of DNA sample and water (qsp 20 µL). abortus, we used enoA_CabF13 5′-AACAACGGCCTGCAATTTCAAG-3′and enoA_CabR124 5′-TGAGAAGGTTTTTCAATGTATGGAAC-3′ primers, as well as the probe enoA_CabP93 5′- GGCACCCATACGTACAGCTTCTTG -3′. psittaci detection, we used enoA_CpsF43 5′-ATTCGCCCTATAGGTGCACAT-3′ and enoA_CpsR162 5′-GCCTTCATCTCCAACTCCTGTAG-3′ primers and the probe enoA_CpsP79 5′- GTGCGTATGGGTGCTGATGTTT -3′. abortus strains compared to traditional methods. abortus rtPCRs, developed and already in use in Anses laboratory in order to improve the detection of C. Īll samples that gave a positive signal with the 23S-rtPCR were re-examined with in-house-specific enoA-based C. psittaci genotype M56, originally isolated from muskrat, has also been highlighted in wild raptors. psittaci genotypes, designated 1V, 6N, Mat116, R54, YP84, CPX0308, I, J, G1 and G2, have been proposed. All genotypes were considered to be readily transmissible to humans. The transition to DNA-based typing methods was facilitated by the equivalence detected in most cases between serotypes and genotypes. Later, the serotyping method was replaced by faster genotyping techniques, obtaining A–F genotypes and an additional genotype E/B. psittaci strains were initially performed by monoclonal antibody typing, obtaining six avian serovars (A–F). Depending on the virulence of the strain and the avian host, chlamydiosis can be subclinical or characterised by ocular, respiratory and enteric signs, with intermittent bacterial excretion, especially in stressful situations (migration, breeding, illness). psittaci is the longest known aetiological agent of chlamydiosis, detected in poultry, pet and free-living birds. abortus strains in Italy, specifically genotype 1V, confirming that they are actively circulating in corvids in the Italian region tested. To our knowledge, this is the first report of avian C. The plasmid sequences were highly similar (≥99%) to those of the Polish avian C. abortus, both samples, as well as two samples from hooded crows, showed the chlamydial plasmid inherent in most C. To confirm the intermediate characteristics between C. abortus genotyping, multilocus sequence typing was successfully performed on the two samples with high DNA load from Eurasian magpies, highlighting 100% identity with the recently reported Polish avian C. psittaci-positive sample was undertaken via PCR/high-resolution melting, clustering it in group III_pigeon, corresponding to the B genotype based on former ompA analysis. abortus positivity in seven samples, two from Eurasian magpies and five from hooded crows. psittaci positivity in only one sample from a hooded crow and C. Molecular characterisation at the species level was possible in 8/12 samples, showing C. Cloacal shedding of Chlamydiaceae was detected in 12 out of 108 (11.1%, 5.9%–18.6% 95% CI) corvids sampled. The positive samples were characterised by specific rtPCRs for Chlamydia psittaci, Chlamydia abortus, Chlamydia gallinacea, Chlamydia avium, Chlamydia pecorum and Chlamydia suis. In this study, DNA extracted from cloacal swabs of 108 corvids from Northeast Italy was screened for Chlamydiaceae by 23S real-time (rt)PCR. Chlamydiaceae occurrence has been largely evaluated in wildlife, showing that wild birds are efficient reservoirs for avian chlamydiosis.
0 Comments
Leave a Reply. |
AuthorWrite something about yourself. No need to be fancy, just an overview. ArchivesCategories |